Zakażenie wirusem zapalenia wątroby typu C u pacjentów z pierwotną hipogammaglobulinemią po leczeniu skażoną globuliną immunologiczną ad

Frakcjonowanie w zimnym etanolu nie usuwa całego RNA HCV z frakcji II użytej do przygotowania immunoglobuliny13. Użyto tylko osocza od pacjentów z negatywnym antygenem powierzchniowym wirusa zapalenia wątroby typu B. Po wycofaniu zakażonego preparatu immunoglobuliny z rynku większość naszych pacjentów otrzymało dożylne leczenie dwiema innymi immunoglobulinami, z których żadna nie była związana z zapaleniem wątroby bez A, nie B. Przez ostatnie cztery do pięciu lat większość naszych pacjentów leczono podskórnymi infuzjami standardowej immunoglobuliny.
Badania wirusologiczne
Najnowszą próbkę surowicy dostępną od każdego pacjenta badano na HCV RNA metodą PCR. W przypadku pacjentów leczonych interferonem badano najnowszą próbkę surowicy uzyskaną przed terapią interferonem. Próbki surowicy seryjnej badano u wybranych pacjentów w celu ustalenia statusu HCV RNA w kierunku wzdłużnym. W przypadku pacjentów eksponowanych na produkt zanieczyszczonej globuliny immunologicznej, którzy byli ujemni na HCV RNA w 1992 i 1993 r., Testowano również poprzednie próbki surowicy. Ponadto, wszyscy pacjenci zostali przebadani na obecność anty-HCV za pomocą testu immunoenzymatycznego drugiej generacji (Abbott Diagnostika, Wiesbaden, Niemcy). Dodatkowe testy przeprowadzono za pomocą testu (HCV Riba 3.0 SIA, Chiron, Emeryville, CA), który wykrywa przeciwciała przeciwko antygenom pochodzącym z domniemanych niestrukturalnych regionów wirusa (rekombinowane antygeny c33-c i NS5 oraz syntetyczne peptydy c100-p i 5- 1-1p) i przeciwko syntetycznemu peptydowi c22-p, odpowiadającemu domniemanemu białku wirusowemu nukleokapsydu. Próbki surowicy od wszystkich pacjentów były również badane pod kątem antygenu powierzchniowego wirusa zapalenia wątroby typu B (Ausria II-125, Abbott Laboratories Diagnostics Division, North Chicago, Illinois).
Wykrywanie RNA HCV i genotypowanie
Próbki surowicy przechowywano w temperaturze -70 ° C. RNA ekstrahowano z 200 mikrolitrów surowicy zmodyfikowaną metodą kwasowego guanidyniowego tiocyjanianu-fenolu-chloroformu, jak opisano w innym miejscu, 14-16 zamrożono natychmiast i utrzymywano w -20 ° C do czasu użycia.
Startery do komplementarnej syntezy DNA (cDNA) i zagnieżdżonej PCR pochodziły z konserwatywnego 5 niekodującego regionu genomu HCV17. Sekwencje to 5 CGTTAGTATGAGTGTCGTGC3 (PT1, zewnętrzny sens), 5 CGGTGTACTCACCGGTTCC3 (PT2, zewnętrzny antysens), 5 AGTGTCGTGCAGCCTCCAGG3 (PT3, wewnętrzny sens) i 5 CGGTTCCGCAGACCACTATG3 (PT4, wewnętrzny antysens). RNA poddano odwracalnej translacji do cDNA w 37 ° C przez 60 minut w 20-mikrolitrowej mieszaninie reakcyjnej zgodnie z protokołem opisanym gdzie indziej15. Zastosowano osiemdziesiąt osiem pikomoli zewnętrznego primera antysensownego. Po inaktywacji odwrotnej transkryptazy (M-Mulv, Pharmacia, Freiburg, Niemcy) w 95 ° C przez pięć minut, 50 pmoli zewnętrznego primera sensownego dodano do cDNA i jednostkę polimerazy DNA Amplitaq (Perkin-Elmer Cetus, Norwalk , Conn.) W objętości 80 mikrolitrów zawierających 50 mmol chlorku potasu, 10 mmol kwasu TRIS-chlorowodorowego (pH 8,3) i 1,5 mmol dichlorku magnezu na litr roztworu. PCR przeprowadzono w TempCycler (Coy, Ann Arbor, Mich.). Pierwszą reakcję prowadzono z 25 cyklami minuty w 95 ° C, minutą w 45 ° C i minutą 40 sekund w 72 ° C, z końcowym etapem elongacji wynoszącym 5 minut w 72 ° C.
Drugą reakcję PCR przeprowadzono w 100-mikrolitrowej mieszaninie reakcyjnej zgodnie z protokołem opisanym gdzie indziej, 15 z 2 mikrolitrami pierwszego produktu reakcji i po 50 pmoli każdego z wewnętrznych sensownych i wewnętrznych starterów antysensownych.
[przypisy: leczenie kanałowe warszawa, internista wikipedia, podniebienie miękkie ]

Powiązane tematy z artykułem: internista wikipedia leczenie kanałowe warszawa podniebienie miękkie